**Example: Full `RefgetStore` Usage**

```r
library(gtars)

temp_dir <- tempdir()

# 1. Prepare a dummy FASTA file
temp_fasta_path <- file.path(temp_dir, "source.fa")
fasta_content <- paste(
  ">chr1",
  "ATGCATGCATGCAGTCGTAGC",
  ">chr2",
  "GGGGAAAA",
  sep = "\n"
)
writeLines(fasta_content, temp_fasta_path)

# 2. Digest the FASTA to get collection info and digest
collection <- digest_fasta(temp_fasta_path)
collection_digest <- collection@digest
cat(sprintf("Source FASTA digested. Collection digest: %s\n", collection_digest))

# 3. Create an in-memory RefgetStore in Encoded mode
store <- refget_store("encoded")
print(store)

# 4. Add the FASTA to the store
added <- add_fasta(store, temp_fasta_path)
cat(sprintf("FASTA added to the store as collection %s\n", added$digest))

# 5. Get a sequence by its digest (from the first sequence in the collection)
seq_digest_chr1 <- collection[1]@metadata@sha512t24u
record_chr1 <- get_sequence(store, seq_digest_chr1)
if (!is.null(record_chr1)) {
  cat(sprintf("Retrieved sequence by digest: %s, length %s\n",
              record_chr1@metadata@name, record_chr1@metadata@length))
  cat(sprintf("  Sequence (full): %s\n",
              get_substring(store, seq_digest_chr1, 0, record_chr1@metadata@length)))
}

# Or look it up by collection and name
record_chr2 <- get_sequence_by_name(store, collection_digest, "chr2")

# 6. Get a substring (0-based, half-open)
sub_seq <- get_substring(store, seq_digest_chr1, 5, 15)
cat(sprintf("Substring from chr1[5:15]: %s\n", sub_seq))

# 7. Prepare a BED file for region retrieval
temp_bed_path <- file.path(temp_dir, "test.bed")
bed_content <- paste(
  "chr1\t0\t10",
  "chr2\t2\t6",
  "chr_nonexistent\t0\t5",
  sep = "\n"
)
writeLines(bed_content, temp_bed_path)

# 8. Retrieve sequences from the BED file into memory.
# Regions on unknown sequences (chr_nonexistent) are skipped with a warning.
retrieved_list <- get_seqs_bed_file_to_vec(store, collection_digest, temp_bed_path)
cat("Retrieved sequences from BED file (as list):\n")
for (rs in retrieved_list) {
  print(rs)
}

# The same, as a data.frame with columns sequence, chrom_name, start, end
retrieved_df <- get_seqs_bed_file_to_df(store, collection_digest, temp_bed_path)

# 9. Write BED regions to a new FASTA file.
# Unlike step 8, this stops with an error on unknown sequences,
# so give it a BED file with valid regions only.
valid_bed_path <- file.path(temp_dir, "valid.bed")
writeLines(paste("chr1\t0\t10", "chr2\t2\t6", sep = "\n"), valid_bed_path)
temp_output_fa_path <- file.path(temp_dir, "output.fa")
get_seqs_bed_file(store, collection_digest, valid_bed_path, temp_output_fa_path)
cat(sprintf("Retrieved sequences from BED file written to: %s\n", temp_output_fa_path))

# 10. Export the whole collection (or selected sequences) to FASTA
export_fasta(store, collection_digest, file.path(temp_dir, "all.fa"))
export_fasta(store, collection_digest, file.path(temp_dir, "chr1.fa"),
             sequence_names = c("chr1"), line_width = 60)

# 11. Write store to a new directory.
# In the template, %s2 is the first 2 characters of the digest and %s the full digest.
temp_saved_store_path <- file.path(temp_dir, "my_refget_store")
write_store_to_directory(store, temp_saved_store_path, "sequences/%s2/%s.seq")
cat(sprintf("Store saved to: %s\n", temp_saved_store_path))

# 12. Open the store from the directory
store_load <- refget_store_open_local(temp_saved_store_path)
cat(sprintf("Store successfully loaded from: %s\n", temp_saved_store_path))
print(store_load)
```

A saved store can also be served over HTTP and opened remotely with
`refget_store_open_remote(cache_path, remote_url)`. The server must support HTTP
range requests; see the [Python reference](/gtars/python/refget-store.md) for details.